Order from us for quality, customized work in due time of your choice.
After bombardment, the somatic embryos of the papaya (Carica papaya) will be selected on medium containing 150 g mL1 kanamycin monosulfate for 3 months. According to Drew and Smith(1986), germination of the papaya then will be induced on a modified de Fossard medium (de Fossard et al., 1974) and will be supplemented with 25 g mL1 kanamycin. Single plantlets will then transferred into vessels containing the same medium without kanamycin. In the culture medium, high concentration of minerals and hormones will be added to improve shoot growth and quality as well as to enhance the growth of the callus. 1 ¼ mol l1 of NAA and BAP will be added to the modified Fossard medium which will induce shoot growth and cause excessive callus production. Both plantlets, with and without kanamycin, then will be clonally multiplied in tissue culture using the method described by Drew (1988). He stated that the cultures will be created from buds of 3- month old papaya plants, followed by enhancement of axillary shoot growth on Drew and Smith (DS) medium containing 1 mM BAP + 0.25mM NAA. After that, stem apices will be removed from mature field-grown papaya (Carica papaya L.) and the area of cut will be applied with mixture that contains 225 mg BAP/liter of lanolin. Thus, will promote rapid development of axillary branches on rooted cuttings. Small axillary buds will be removed from these branches and cultured on solid medium, and then in liquid medium on a roller drum at 3 rpm in Drew and Smith (DS) medium containing 1 mM BAP+ 1 mM NAA. After two or three subcultures on the roller drum with alternate periods on hormone-free basal medium, apically dominant shoots were produced. Roots will be initiated through incubation process at 27°C in a 12-hr photoperiod on a reduced mineral medium containing 10 mM IBA.
Genomic DNA was extracted from papaya leaf tissue of the regenerated papaya plants as described by Lassner et al. (1989). Plantlets that regenerated on kanamycin will be analysed by PCR method. An 864 bp fragment of the coat protein coding region will be amplified from approximately 1 g of genomic DNA in a standard PCR reaction using Taq polymerase and includes 30 moles of each primer, MB11 and MB12 (Bateson et al. 1994). The primers MB13 (GGGAGTGAGGAATGATTATGGCC) and MB12 will be used to amplify partial fragment of the coat protein coding region.. PCR amplification conditions include an initial denaturation cycle of 5mins at 94 °C followed by 35 cycles of denaturation for 30s at 94 °C, annealing for 30s at 55 °C and extension for 30s at 72 °C, with a final extension of 10 mins at 72 °C. Following PCR, southern hybridisation will be applied to define transgene copy number in selected lines. Restriction enzymes will then selected that either cut once in the transformation vector p2KCP9 (HindIII), to estimate the number of integrated copies of the transgene, or did not cut at all in the transformation vector (BglII), to estimate the number of different integration sites. Genomic DNA (10 g) will then digested with HindIII or BglII and electrophoresed on a 0.8% agarose gel. DNA will be immobilised on Hybond N nylon membrane (Boehringer Mannheim) after capillary transfer (Southern 1975) in 20 × SSC. Digoxigenin (DIG) labelled probes, homologous to the PRSV-P coat protein (CP) coding region from the plasmid p2KCP9 were made using primers MB11 and MB12 and incorporating DIG-labelled dNTPs (17:1) (Boehringer Mannheim). Approximately 5 g of the probe will be used for hybridisation to the membrane. The DIG label will be detected using the chemiluminescent substrate CDP Star according to the manufacturer (Boehringer Mannheim).
Total RNA will extracted from both inoculated and non-inoculated papaya leaves using a modification of the method by Glisin et al. (1974). 2 g of the tissue will be grounded in liquid nitrogen and extracted with 25 mL of RNA extraction buffer (25 mM trisodium citrate pH 7, containing guanidinium isothiocyanate (50% w/v), 1.2% n-lauryl sarcosine, and 0.7% mercaptoethanol). Following centrifugation (2,000 × g, 10 min), the supernatant will then filtered through miracloth and layered over 6.18 mL of 5.7 M cesium chloride containing 0.1 M EDTA. Samples will undergo centrifugation for 18 hours at 68,566 × g in a Beckman SW28 rotor. RNA pellets will resuspended in 200 L DEPC-treated water, clarified by low speed centrifugation and ethanol precipitated. RNA was resuspended in a final volume of 20 L DEPC-treated water. For northern hybridisation, 20 g total RNA, determined by UV spectrophotometry will be electrophoresed on an 8% formaldehyde denaturing gel (Sambrook et al. 1989). The RNA will then transferred to Hybond N nylon membrane using capillary transfer and the membrane will be hybridised with DIG-labelled coat protein fragment probe.
Total protein will be extracted from transgenic papaya plants using commercially available protease inhibitor tablets according to the manufacturers instructions and 15 g of protein will be western blotted onto nitrocellulose membrane according to Sambrook et al. (1989). Detection of the PRSV coat protein will be attempted using PRSV specific antisera (Bateson 1995). Swine anti-rabbit IgG conjugated to horseradish peroxidase (HRP)(DAKO) will be used as the secondary antibody. For HRP, Lumi-Light Plus Western Blotting Substrate (Boehringer Mannheim) will be used as the substrate.
Regenerated plantlets also acclimatised to the glass-house. As described by Drew (1988), shoots will be established in a high-humidity (> 90%) cabinet in a glasshouse and planted in the field. Acclimatised plants will be grown under glasshouse conditions for 2 months before mechanical inoculation with PRSV-P.
The mechanical inoculation process involve grounding of the leaves from PRSV-P infected-field grown papaya in 0.1 M potassium phosphate buffer pH 7.0. Transgenic plants and non-transgenic controls will be dusted with carborundum. Also, the youngest two fully expanded leaves of each plant will be rub with phosphate buffer or papaya sap mixture. This inoculation process will be repeated 1 week and 3 weeks after the initial inoculation.
References
- Bateson M.F., Henderson J., Chaleeprom W., Gibbs A.J. and Dale J.L. 1994. Papaya ringspot potyvirus isolate variability and the origin of PRSV type P (Australia). J. Gen. Virol. 75: 35473553.
- Bateson M.F. 1995. Developing transgenic resistance for potyviruses. PhD Dissertation, Queensland University of Technology. de Fossard R.R., Myint A. and Lee E.C.M. 1974. A broad spectrum tissue culture experiment with tobacco (Nicotianatabacum) pith tissue callus. Physiol Plantarum 30: 125130.
- Drew R.A. and Smith N.G. 1986. Growth of apical and lateral buds of papaya (Carica papaya L.) as affected by nutritional and hormonal factors. J. Hort. Sci. 61: 535543.
- Drew R.A. 1988. Rapid clonal propagation of papaya in vitro from mature field-grown trees. HortScience 23: 609611.
- Lassner M.W., Peterson P. and Yoder J.I. 1989. Simultaneous amplification of multiple DNA fragments by polymerase chain reaction in the analysis of transgenic plants and their progeny. Plant Mol. Biol. Rep. 7: 116128.
- Sambrook J., Fritsch E.F. and Maniatis T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory,Cold Spring Harbour, New York.
Order from us for quality, customized work in due time of your choice.